JCSG Target History SARS1:D7

		Search JCSG

Target ID:

355891

Target Name:

SARS024

Protein Accession:

29837497

Local Accession:

SARS024

cDNA Accession:

29837497

PSCA

PDB:2gri

PDB:2idy

Hover over nodes to see experimental data. Click on nodes to go to that point in the data below.

Proposed Target

Active Target

PCR Testing

Amplifer Generation

Orientation

Plasmid Purification

Expression

Protein Purification

Crystal Setup

Crystallization

NMR Structure

Refining

PDB Deposition

Proposed Target

Active Target

PCR Testing

Amplifer Generation

Orientation

Plasmid Purification

Expression

Protein Purification

Crystal Setup

Crystallization

NMR Structure

Refining

PDB Deposition

Status View


Chrono View

Name:	SARS-CoV non-structural protein nsp3a.	Start Position:	1	End Position:	112
GNF Target Alias:	TSRI-SARS024-dum-2422-1-112	Sequence Type:	TRUNCATED	Residues:	112
DNA Length:	336	Molecular Weight:	12639.45	Isoelectric Point:	4.10
Isoelectric Point (Incl. Tag):	4.59	Epsilon 280:	18450	Gravy Index:	-0.14
Species:	SARS-Tor2	Activated:	1	Alanine Absolute:	6
Alanine Relative:	0.0536	Arginine Absolute:	3	Arginine Relative:	0.0268
Asparagine Absolute:	4	Asparagine Relative:	0.0357	Aspartic Acid Absolute:	9
Aspartic Acid Relative:	0.0804	Cysteine Absolute:	3	Cysteine Relative:	0.0268
Glutamic Acid Absolute:	13	Glutamic Acid Relative:	0.1161	Glutamine Absolute:	2
Glutamine Relative:	0.0179	Glycine Absolute:	6	Glycine Relative:	0.0536
Histidine Absolute:	0	Histidine Relative:	0.0000	Isoleucine Absolute:	3
Isoleucine Relative:	0.0268	Leucine Absolute:	7	Leucine Relative:	0.0625
Lysine Absolute:	5	Lysine Relative:	0.0446	Methionine Absolute:	2
Methionine Relative:	0.0179	Phenylalanine Absolute:	7	Phenylalanine Relative:	0.0625
Proline Absolute:	4	Proline Relative:	0.0357	Serine Absolute:	7
Serine Relative:	0.0625	Threonine Absolute:	9	Threonine Relative:	0.0804
Tryptophan Absolute:	2	Tryptophan Relative:	0.0179	Tyrosine Absolute:	5
Tyrosine Relative:	0.0446	Valine Absolute:	15	Valine Relative:	0.1339
Project:	SARS-1	Comment:	Glu-rich C-terminal domain. The Glu-rich domain (Prosite PS50313) is located between positions 112 and 183.	Selection Date:	2003-03-11

STAGE: Proposed Target

Plate: 0 Cell: 355891 Date: 2003-03-11 Status: Success

STAGE: Active Target

Plate: 15208 (SARS-1) Cell: D7 Date: 2003-03-11 Status: Success - Backfilled Previous Location: Plate: 0 Cell: 355891

Temperature (C): 62.5 Date: 2003-07-28
Temperature Tolerance (C): 2.5 Date: 2003-07-28
Salt Concentration (uM): 100 Date: 2003-07-28
Forward Primer: GCACCAATTAAAGGTGTAACCTTTGG Date: 2003-07-28
Reverse Primer: CCCGGCCGGCCCTACTCATCTGGAGGGTAAAAGG Date: 2003-07-28
Primer Plate: 15208 Date: 2003-07-28
Primer Well: D7 Date: 2003-07-28
Target Alias: SARS1:D7 Date: 2003-07-28

Plate: 37667 Cell: 999 Date: 2005-09-01 Status: Success - Backfilled Previous Location: Plate: 0 Cell: 355891

STAGE: PCR Testing

Plate: 20631 (SARS-1) Cell: D7 Date: 2003-03-11 Status: Success - Backfilled Previous Location: Plate: 15208 (SARS-1) Cell: D7

Plate: 37668 Cell: 999 Date: 2005-09-01 Status: Success - Backfilled Previous Location: Plate: 37667 Cell: 999

STAGE: Amplifer Generation

Plate: 20632 (SARS-1) Cell: D7 Date: 2003-03-11 Status: Success - Backfilled Previous Location: Plate: 20631 (SARS-1) Cell: D7

Vector: his Date: 2003-11-19

Plate: 37669 Cell: 999 Date: 2005-09-01 Status: Success - Backfilled Previous Location: Plate: 37668 Cell: 999

STAGE: Orientation

Plate: 20633 (SARS-1) Cell: D7 Date: 2003-03-11 Status: Success - Backfilled Previous Location: Plate: 20632 (SARS-1) Cell: D7

Plate: 37670 Cell: 999 Date: 2005-09-01 Status: Success - Backfilled Previous Location: Plate: 37669 Cell: 999

STAGE: Plasmid Purification

Plate: 20675 (SARS-1) Cell: D7 Date: 2003-03-11 Status: Success - Backfilled Previous Location: Plate: 20633 (SARS-1) Cell: D7

Plate: 37672 Cell: 999 Date: 2005-09-01 Status: Success - Backfilled Previous Location: Plate: 37670 Cell: 999

Cloned Date: 2005-09-01 Date: 2006-05-30

STAGE: Expression

Plate: 20681 (SeMet 11-6-03) Cell: A3 Date: 2003-11-10 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Se-Met Date: 2003-11-26

Plate: 20707 (SARS1:D7 from 9-24-03) Cell: H10 Date: 2003-11-25 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2003-11-26

Plate: 20708 (SARS1:D7 from 9-30-03) Cell: A5 Date: 2003-11-25 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2003-12-15

Plate: 20709 (SARS1:D7 from 10-02-03) Cell: D12 Date: 2003-10-06 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2003-11-26

Plate: 20710 (SARS1:D7 labelled from 10-08-03) Cell: A5 Date: 2003-11-25 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Se-Met Date: 2004-03-08

Plate: 20710 (SARS1:D7 labelled from 10-08-03) Cell: A7 Date: 2003-06-10 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2004-03-08

Plate: 20718 (SARS1:D7 from 10-21-03) Cell: A8 Date: 2003-11-25 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2003-11-26

Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6 Date: 2003-11-03 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2003-11-26

Plate: 20722 (SARS1:D7 from 11-06-03) Cell: A3 Date: 2003-11-10 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Se-Met Date: 2003-11-26

Plate: 21130 (SARS1_37deg) Cell: D7 Date: 2003-03-11 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2004-03-08

Plate: 21131 (SARS1_13deg) Cell: D7 Date: 2004-01-19 Status: JCSG1 Success Previous Location: Plate: 20675 (SARS-1) Cell: D7

Plate: 21132 (SARS1_4deg) Cell: D7 Date: 2003-11-10 Status: Success - Backfilled Previous Location: Plate: 20675 (SARS-1) Cell: D7

Media: Native-TB Date: 2004-03-09

Collection: 27999 Cell: 1 Date: 2004-10-20 Status: Success Previous Location: Plate: 20675 (SARS-1) Cell: D7

Fermentation Date: 2004-10-20 Date: 2004-10-25
Media: Native-TB Date: 2004-10-25
Total Expression: Weak Date: 2004-10-25
Soluble Expression: Weak Date: 2004-10-25
Gel Observed MW (kDa): 14 Date: 2004-10-25
Next Location: Coarse Screen Date: 2004-10-25

Plate: 37673 Cell: 999 Date: 2005-09-30 Status: Success - Backfilled Previous Location: Plate: 37672 Cell: 999

Fermentation Date: 2005-09-15 Date: 2006-05-30
GNFuge Date: 2005-09-15 Date: 2006-05-30

STAGE: Protein Purification

Plate: 20681 (SeMet 11-6-03) Cell: A3 Date: 2003-11-10 Status: Success Previous Location: Plate: 20681 (SeMet 11-6-03) Cell: A3

Soluble: 1 Date: 2003-11-26
Ion exchange run completed: 1 Date: 2003-11-26
Gel Filtration column run: 0 Date: 2003-11-26
Absorbance of protein post concentration: 18.425 Date: 2003-11-26
Volume of sample post concentration: 159 Date: 2003-11-26
Storage: -80 Date: 2003-11-26
Yield: 2006.949357 Date: 2003-11-26
Purified Concentration (mg/mL): 12.622323 Date: 2003-11-26
Protein Version: 1 Date: 2003-11-26
Purification Date: 2003-11-10 Date: 2003-11-26

Plate: 20707 (SARS1:D7 from 9-24-03) Cell: H10 Date: 2003-11-26 Status: JCSG1 Success Previous Location: Plate: 20707 (SARS1:D7 from 9-24-03) Cell: H10

Soluble: 0 Date: 2003-11-26
Ion exchange run completed: 0 Date: 2003-11-26
Gel Filtration column run: 0 Date: 2003-11-26
Storage: 0 Date: 2003-11-26
Yield: 0.000000 Date: 2003-11-26
Purified Concentration (mg/mL): 0.000000 Date: 2003-11-26

Plate: 20708 (SARS1:D7 from 9-30-03) Cell: A5 Date: 2003-12-15 Status: JCSG1 Success Previous Location: Plate: 20708 (SARS1:D7 from 9-30-03) Cell: A5

Soluble: 0 Date: 2003-12-15
Ion exchange run completed: 0 Date: 2003-12-15
Gel Filtration column run: 0 Date: 2003-12-15
Storage: 0 Date: 2003-12-15
Yield: 0.000000 Date: 2003-12-15
Purified Concentration (mg/mL): 0.000000 Date: 2003-12-15

Plate: 20709 (SARS1:D7 from 10-02-03) Cell: D12 Date: 2003-10-06 Status: Success Previous Location: Plate: 20709 (SARS1:D7 from 10-02-03) Cell: D12

Soluble: 1 Date: 2003-11-26
Ion exchange run completed: 1 Date: 2003-11-26
Gel Filtration column run: 0 Date: 2003-11-26
Absorbance of protein post concentration: 17.97 Date: 2003-11-26
Volume of sample post concentration: .136 Date: 2003-11-26
Storage: -80 Date: 2003-11-26
Yield: 1.674244 Date: 2003-11-26
Purified Concentration (mg/mL): 12.310619 Date: 2003-11-26
Protein Version: 2 Date: 2003-11-26
Purification Date: 2003-10-06 Date: 2003-11-26

Plate: 20710 (SARS1:D7 labelled from 10-08-03) Cell: A5 Date: 2004-02-16 Status: Success Previous Location: Plate: 20710 (SARS1:D7 labelled from 10-08-03) Cell: A5

Soluble: 1 Date: 2004-03-08
Ion exchange run completed: 1 Date: 2004-03-08
Gel Filtration column run: 0 Date: 2004-03-08
Absorbance of protein post concentration: 3.11 Date: 2004-03-08
Absorbance of blank post concentration: 0.0 Date: 2004-03-08
Volume of sample post concentration: 0.06 Date: 2004-03-08
Storage: 0 Date: 2004-03-08
Yield: 0.127833 Date: 2004-03-08
Purified Concentration (mg/mL): 2.130552 Date: 2004-03-08
Protein Version: 5 Date: 2004-03-08
Purification Date: 2004-02-16 Date: 2004-03-08

Plate: 20710 (SARS1:D7 labelled from 10-08-03) Cell: A7 Date: 2003-06-10 Status: Success Previous Location: Plate: 20710 (SARS1:D7 labelled from 10-08-03) Cell: A7

Soluble: 1 Date: 2004-03-08
Ion exchange run completed: 1 Date: 2004-03-08
Gel Filtration column run: 0 Date: 2004-03-08
Absorbance of protein post concentration: 1.46 Date: 2004-03-08
Volume of sample post concentration: 0.136 Date: 2004-03-08
Storage: -80 Date: 2004-03-08
Yield: 0.136027 Date: 2004-03-08
Purified Concentration (mg/mL): 1.000195 Date: 2004-03-08
Protein Version: 6 Date: 2004-03-08
Purification Date: 2003-06-10 Date: 2004-03-08

Plate: 20718 (SARS1:D7 from 10-21-03) Cell: A8 Date: 2003-11-26 Status: JCSG1 Success Previous Location: Plate: 20718 (SARS1:D7 from 10-21-03) Cell: A8

Soluble: 0 Date: 2003-11-26
Ion exchange run completed: 0 Date: 2003-11-26
Gel Filtration column run: 0 Date: 2003-11-26
Storage: 0 Date: 2003-11-26
Yield: 0.000000 Date: 2003-11-26
Purified Concentration (mg/mL): 0.000000 Date: 2003-11-26

Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6 Date: 2003-11-03 Status: Success Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6

Soluble: 1 Date: 2003-11-26
Ion exchange run completed: 1 Date: 2003-11-26
Gel Filtration column run: 0 Date: 2003-11-26
Absorbance of protein post concentration: 18.0 Date: 2003-11-26
Volume of sample post concentration: .175 Date: 2003-11-26
Storage: -80 Date: 2003-11-26
Yield: 2.157955 Date: 2003-11-26
Purified Concentration (mg/mL): 12.331171 Date: 2003-11-26
Protein Version: 3 Date: 2003-11-26
Purification Date: 2003-11-03 Date: 2003-11-26

Plate: 20722 (SARS1:D7 from 11-06-03) Cell: A3 Date: 2003-11-10 Status: Success Previous Location: Plate: 20722 (SARS1:D7 from 11-06-03) Cell: A3

Soluble: 1 Date: 2003-11-26
Ion exchange run completed: 1 Date: 2003-11-26
Gel Filtration column run: 0 Date: 2003-11-26
Absorbance of protein post concentration: 18.4 Date: 2003-11-26
Volume of sample post concentration: .159 Date: 2003-11-26
Storage: -80 Date: 2003-11-26
Yield: 2.004226 Date: 2003-11-26
Purified Concentration (mg/mL): 12.605197 Date: 2003-11-26
Protein Version: 4 Date: 2003-11-26
Purification Date: 2003-11-10 Date: 2003-11-26

Plate: 21130 (SARS1_37deg) Cell: D7 Date: 2003-03-11 Status: Success Previous Location: Plate: 21130 (SARS1_37deg) Cell: D7

Soluble: 1 Date: 2004-03-08
Ion exchange run completed: 1 Date: 2004-03-08
Gel Filtration column run: 0 Date: 2004-03-08
Absorbance of protein post concentration: 1.43 Date: 2004-03-08
Volume of sample post concentration: 0.175 Date: 2004-03-08
Storage: -80 Date: 2004-03-08
Yield: 0.171438 Date: 2004-03-08
Purified Concentration (mg/mL): 0.979643 Date: 2004-03-08
Protein Version: 7 Date: 2004-03-08
Purification Date: 2003-03-11 Date: 2004-03-08

Plate: 21132 (SARS1_4deg) Cell: D7 Date: 2003-11-10 Status: Success Previous Location: Plate: 21132 (SARS1_4deg) Cell: D7

Soluble: 1 Date: 2004-03-09
Ion exchange run completed: 1 Date: 2004-03-09
Gel Filtration column run: 0 Date: 2004-03-09
Absorbance of protein post concentration: 1.5 Date: 2004-03-09
Volume of sample post concentration: 0.159 Date: 2004-03-09
Storage: -80 Date: 2004-03-09
Yield: 0.163388 Date: 2004-03-09
Purified Concentration (mg/mL): 1.027598 Date: 2004-03-09
Protein Version: 8 Date: 2004-03-09
Purification Date: 2003-11-10 Date: 2004-03-09

Collection: 27999 Cell: 1 Date: 2004-11-01 Status: Success Previous Location: Collection: 27999 Cell: 1

Soluble: 1 Date: 2005-02-11
Ion exchange run completed: 1 Date: 2005-02-11
Gel Filtration column run: 0 Date: 2005-02-11
Absorbance of protein post concentration: 7.905 Date: 2005-02-11
Volume of sample post concentration: .670 Date: 2005-02-11
Storage: -80 Date: 2005-02-11
Yield: 3.628344 Date: 2005-02-11
Purified Concentration (mg/mL): 5.415439 Date: 2005-02-11
Protein Version: 9 Date: 2005-02-11
Purification Date: 2004-11-01 Date: 2005-02-11

Plate: 37674 Cell: 999 Date: 2005-09-30 Status: Success - Backfilled Previous Location: Plate: 37673 Cell: 999

Purification Date: 2005-09-30 Date: 2006-05-30

STAGE: Crystal Setup

Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6A Date: 2003-12-16 Status: Success - Backfilled Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6

Final Concentration (mg/mL): 12.331171 Date: 2003-12-16
TSRI number assigned: 798 Date: 2003-12-16

STAGE: Crystallization

Plate: 20962 (C0098374) Cell: XT Date: 2003-12-16 Status: JCSG1 Success Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6A

Screen Type: Coarse Date: 2003-12-16
Setup Temp: 4 Date: 2003-12-16
Crystal Conditions: Hampton CS I/II Date: 2003-12-16

Plate: 20963 (C0093398) Cell: XT Date: 2003-12-16 Status: JCSG1 Success Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6A

Screen Type: Coarse Date: 2005-06-16
Setup Temp: 4 Date: 2003-12-16
Crystal Conditions: Syrrx Polymer Date: 2003-12-16

Plate: 20964 (C0096198) Cell: XT Date: 2003-12-16 Status: JCSG1 Success Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6A

Screen Type: Coarse Date: 2003-12-16
Setup Temp: 4 Date: 2003-12-16
Crystal Conditions: Wizard I/II Date: 2003-12-16

Plate: 20965 (C0093392) Cell: XT Date: 2003-12-16 Status: JCSG1 Success Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6A

Screen Type: Coarse Date: 2003-12-16
Setup Temp: 20 Date: 2003-12-16
Crystal Conditions: Syrrx Polymer Date: 2003-12-16

Plate: 20966 (C0096192) Cell: XT Date: 2003-12-16 Status: JCSG1 Success Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6A

Screen Type: Coarse Date: 2005-06-16
Setup Temp: 20 Date: 2003-12-16
Crystal Conditions: Wizard I/II Date: 2003-12-16

Plate: 20967 (C0098369) Cell: XT Date: 2003-12-16 Status: JCSG1 Success Previous Location: Plate: 20720 (SARS1:D7&E11 from 10-30-03) Cell: A6A

Screen Type: Coarse Date: 2005-06-16
Setup Temp: 20 Date: 2003-12-16
Crystal Conditions: Hampton CS I/II Date: 2003-12-16

STAGE: NMR Structure

Plate: 37675 Cell: 999 Date: 2006-04-24 Status: Success - Backfilled Previous Location: Plate: 37674 Cell: 999

STAGE: Refining

Collection: 37676 Cell: 999 Date: 2006-04-24 Status: Success - Backfilled Previous Location: Plate: 37675 Cell: 999

STAGE: PDB Deposition

Collection: 37680 Cell: 1 Date: 2006-04-24 Status: Superseded Previous Location: Collection: 37676 Cell: 999

PDB ID: 2gri Date: 2006-05-31
RCSB ID: rcsb037466 Date: 2006-05-31
PDB File: C--Documents-and-Settings-amorse-Desktop-rcsb037466.pdb Date: 2006-05-31
Deposition Date: 2006-04-24 Date: 2006-05-31

Collection: 37680 Cell: 2 Date: 2006-09-15 Status: Success Previous Location: Collection: 37676 Cell: 999

PDB ID: 2idy Date: 2006-12-07
RCSB ID: rcsb039463 Date: 2006-12-07
PDB File: C--Documents-and-Settings-amorse-Desktop-2idy.pdb Date: 2006-12-07
Deposition Date: 2006-09-15 Date: 2006-12-07


Contact Us

JCSG Menu